morphometric and molecular analysis of gyrodactlus kobayashi in carassius auratus (linnaeus, 1758)
نویسندگان
چکیده
background: fish are constantly exposed to various pathogens and parasites in particular. gyrodactylus from platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in cyprinids. objectives: the present study aimed to identify morphometric and molecular characteristics of gyrodactylus parasite on carassius auratus (linnaeus, 1758). methods: gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. the morphometrical characterization of gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. the molecular species description was based on polymerase chain reaction (pcr) of partial sequence of 5.8s region of ribosomal rna (5´cgatcatcggtctctcgaac3´) and partial sequence of internal transcribed spacer2 (its2) of ribosomal rna (5´ttaaggaagaaccactagag3´). results: gyrodactylus species morphology identification was performed using yamaguti (1961) identification key. the nucleotide sequences of the pcr products were compared with genbank sequences. conclusions: based on morphometric analysis and sequencing, the gyrodactylus specimens were described as gyrodactylus kobayashi. combination of molecular techniques with morphological analysis seems to be the best approach to identification of gyrodactylus spices.
منابع مشابه
Identification of Gyrodactylus gurleyi in Carassius auratus using morphometric and molecular characterization
BACKGROUNDS: Gyrodactylus is a small monogenean ectoparasite that lives on the skin and fins of most of the world's fish species. Gyrodactylus appears to be one of the most prevalent parasites found in ornamental fish, especially in Cyprinids. Goldfish (Carassius auratus) are a popular ornamental fish that are highly contaminated by Gyrodcatylus. OBJECTIVES: The present study is aimed to identi...
متن کاملKaryotype and chromosome banding of endangered crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae)
The karyotype and other chromosomal characteristics the crucian carp (Carassius carassius (Linnaeus, 1758)) were revealed by means of conventional banding protocols (C, CMA3, AgNOR). The diploid chromosome number (2n) in this species was 100. Its karyotype was composed of 10 pairs of metacentric, 18 pairs of submetacentric and 22 pairs of subtelo- to acrocentric chromosomes without any microchr...
متن کاملمطالعه نگهداری کوتاه مدت و انجماد شیشهای جنین ماهی قرمز، carassius auratus, linnaeus 1758
هدف از این مطالعه بهینه کردن روش نگهداری کوتاه مدت و حفاظت انجمادی جنین ماهی قرمز به روش انجماد شیشه ای بود. شش آزمایش به صورت گام به گام برای جستجو شرایط بهینه در نگهداری کوتاه مدت جنین ماهی قرمز طرح ریزی شد. نخست جنین ماهی قرمز در هشت مرحله تکاملی درون آب کلرزدایی و هوادهی شده به مدت 24 ساعت در دمای 0 درجه سانتی گراد نگهداری شدند. نتایج نشان داد که مراحل اولیه تکاملی نسبت به سرد کردن حساسیت ب...
15 صفحه اولMolecular cytogenetic analysis of the crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae), using chromosome staining and fluorescence in situ hybridisation with rDNA probes
The crucian carp Carassius carassius (Linnaeus, 1758) is a species with restricted and decreasing distribution in Europe. Six males and six females of the species from the Baltic Sea basin in Poland were examined to show sequentially CMA3/AgNO3 staining pattern, DAPI staining, and, for the first time in literature, molecular cytogenetic analysis using double-colour fluorescence in situ hybridis...
متن کاملidentification of gyrodactylus gurleyi in carassius auratus using morphometric and molecular characterization
backgrounds: gyrodactylus is a small monogenean ectoparasite that lives on the skin and fins of most of the world's fish species. gyrodactylus appears to be one of the most prevalent parasites found in ornamental fish, especially in cyprinids. goldfish (carassius auratus) are a popular ornamental fish that are highly contaminated by gyrodcatylus. objectives: the present study is aimed to identi...
متن کاملA chromosomal analysis of Nepa cinerea Linnaeus, 1758 and Ranatra linearis (Linnaeus, 1758) (Heteroptera, Nepidae)
An account is given of the karyotypes and male meiosis of the Water Scorpion Nepa cinerea Linnaeus, 1758 and the Water Stick Insect Ranatra linearis (Linnaeus, 1758) (Heteroptera, Nepomorpha, Nepidae). A number of different approaches and techniques were tried: the employment of both male and female gonads and mid-guts as the sources of chromosomes, squash and air-drying methods for chromosome ...
متن کاملمنابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
تحقیقات دامپزشکیجلد ۷۰، شماره ۴، صفحات ۴۲۵-۴۳۲
کلمات کلیدی
میزبانی شده توسط پلتفرم ابری doprax.com
copyright © 2015-2023